The Effect of Phellinus Linteus Cheonghyeol Plus(PLCP) on Antioxidant Activity and Inhibition of Inflammatory Factor Expression Associated with Dyslipidemia in HUVEC

Seo-young Won; Ho-ryong Yoo; In-chan Seol; Yoon-sik Kim; Won, Seo-young; Yoo, Ho-ryong; Seol, In-chan; Kim, Yoon-sik

doi:10.13048/jkm.20014

JKM > Volume 41(2); 2020 > Article

Won, Yoo, Seol, and Kim: The Effect of Phellinus Linteus Cheonghyeol Plus(PLCP) on Antioxidant Activity and Inhibition of Inflammatory Factor Expression Associated with Dyslipidemia in HUVEC

Original Article

The Journal of Korean Medicine 2020; 41(2): 43-57.

Published online: June 1, 2020

DOI: https://doi.org/10.13048/jkm.20014

The Effect of Phellinus Linteus Cheonghyeol Plus(PLCP) on Antioxidant Activity and Inhibition of Inflammatory Factor Expression Associated with Dyslipidemia in HUVEC

Seo-young Won

, Ho-ryong Yoo

, In-chan Seol

, Yoon-sik Kim^*

Dept. of Internal Medicine, College of Korean Medicine, Daejeon University

Correspondence to：김윤식 충남 천안시 서북구 노태산로 4길 대전대학교 대전대부속천안한방병원 한방내과, Tel: +82-41-521-7536, Fax: +82-41-521-7007, E-mail: yoonsik@dju.kr

Received April 24, 2020 Revised May 22, 2020 Accepted May 25, 2020

Abstract

Objectives

The purpose of this study was to investigate the effect of Phellinus linteus cheonghyeol plus (PLCP) on antioxidant and inhibition of inflammatory factor expression associated with dyslipidemia in HUVEC.

Methods

The scavenging activity of DPPH and ABTS radical of PLCP was measured in HUVEC. The expression levels of NF-κB, p-IκBα, ERK, JNK, and p38 proteins were measured after treating with TNF-α in HUVEC. The expression levels of MCP-1, ICAM-1, and VCAM-1 mRNA and biomarkers were measured after treatment with TNF-α in HUVEC

Results

PLCP increases DPPH and ABTS radical scavenging activity in a concentration dependent manner.
PLCP significantly decreased the concentration of NF-κB, p-IκBα, ERK, JNK protein compared to the control at concentrations of 100 μg/ml or more, and significantly decreased concentration of p38 protein at all concentrations.
PLCP significantly decreased MCP-1 mRNA expression levels at 100 μg/ml or more compared to the control. ICAM-1 and VCAM-1 mRNA expression levels were significantly reduced at all concentrations compared to the control. MCP-1, ICAM-1 protein expression levels were significantly reduced compared to the control at concentrations of 100 μg/ml or more, and VCAM-1 protein expression levels were reduced at all concentrations.

Conclusions

These results suggest that PLCP has an antioxidant effect, and it has been experimentally confirmed that it can prevent or inhibit inflammatory diseases caused by dyslipidemia due to its inhibitory effect on inflammation-related factors in HUVEC.

Keywords: Phellinus linteus, Cheonghyeol plus, Dyslipidemia, Antioxidant activity, Anti-inflammatory effect, Atherosclerosis

Fig. 1

Cell viability of PLCP in HUVEC. Cell viability was calculated as percentage relative to the control. The results were presented by the mean ± S.D from four independent experiments.

Fig. 2

DPPH(A) and ABTS(B) radical scavenging activity of PLCP. PLCP was incubated at 1, 10, 100, and 1000/with DPPH solution for 30 mins and ABTS solution for 10 mins. DPPH radical scavenging activities were determined by measurement of absorbance at 517 and ABTS radical scavenging activities were determined by measurement of absorbance at 732. The results were expressed as mean ± S.D from three independent experiments.

Fig. 3

Effect of PLCP on NF-κB(A), IκBα(B), ERK(C), JNK(D) and p38(E) protein expression level in HUVEC. HUVECs were treated 50, 100, and 200/of PLCP with 10 ng/ TNF-α for 12 h. The total cell extracts were subjected to 10% SDS-PAGE and western blot analysis with the respective primary and secondary antibodies. The results were presented by the mean ± S.D from three independent experiments (Significance of results, * ; p≤0.05, ** ; p≤0.01, *** ; p≤0.001 compared to control).

Fig. 4

Effect of PLCP on MCP-1(A), ICAM-1(B) and VCAM-1(C) mRNA expression level in HUVEC. HUVECs were treated 50, 100, and 200/of PLCP with 10 ng/ TNF-α for 12 h. The mRNA expression levels were measured using a quantitative real-time PCR (qRT-PCR). The results were presented by the mean ± S.D from three independent experiments (Significance of results, * ; p≤0.05, ** ; p≤0.01, *** ; p≤0.001 compared to control).

Fig. 5

Effect of PLCP on MCP-1(A), ICAM-1(B) and VCAM-1(C) level in HUVEC. HUVECs were treated 50, 100, and 200/of PLCP with 10 ng/ TNF-α for 12 h. MCP-1(A), ICAM-1(B) and VCAM-1(C) levels were measured using a ELISA kit. The results were presented by the mean ± S.D from three independent experiments (Significance of results, * ; p≤0.05, ** ; p≤0.01, *** ; p≤0.001 compared to control).

Table 1

The Sequences of Primers

Primer	F/R*	Sequences
MCP-1	F	GCTCAGCCAGATGCAATCAA
MCP-1	R	CTTGGCCACAATGGTCTTGA

ICAM-1	F	TCTTCCTCGGCCTTCCCATA
ICAM-1	R	AGGTACCATGGCCCCAAATG

VCAM-1	F	CCCTACCATTGAAGATACTGG
VCAM-1	R	ATCTCTGGGGGCAACATTGAC

β-actin	F	ATCGTGGGGCGCCCCAGGCACCA
β-actin	R	GGGGTACTTCAGGGTGAGGA

* F : forward, R : reverse

참고문헌

1. National Oriental Medical Department of Heart Internal Medicine. Oriental neurocirculatory Internal Medicine. 3rd edition. Seoul: Gunja publishing company;2011. p. 184–5.

2. Statistics Korea. 2018 Death statistics. Korea: Korea development institute;2019.

3. Jung HS. Risks and Management of Dyslipidemia. Public health weekly report. 2019; 12:37. 1416–22.

4. Kim CJ. Atherosclerosis and inflammation. Journal of Lipid and atherosclerosis. 2001; 11:4. 413–9.

5. Choi KE, Seol IC, Kim YS, Cho HK, Yoo HR. Hypolipidemic and Anti-oxidant Effects of Chunghyl Plus in Type II Diabetic Mice Model. J Physiol& Pathol Korean Med. 2016; 30:3. 164–76.

6. Jung ES, Kim HT, Choi KE, Oh JM, Cho HK, Yoo HR, et al. A Case Report of the Beneficial Effects of Chunghyul-Plus in Dyslipidemia Patients. The Journal of the Society of Stroke on Korean Medicine. 2016; 17:1. 56–66.

7. Lim JH, Kim SH, Park NH, Moon CJ, Kang SS, Kim SH, et al. Acute and Chronic Antiinflammatory Effects of Phellinus linteus Water Extract in Rats. Journal of Biomedical Research. 2010; 11:1. 27–35.

8. Yoon HY. Effects of Oral Administration of Phellinus linteus on the Productions of the Th1- and Th2-type Cytokines in Mice. J Life Sic & Nat Res. 2004; 27:1. 63–74.

9. Kim HJ, Jin CB, Lee YS. Studies on the cytotoxicity against tumor cells and antioxidant activities of the fractions of Phellinus linteus. Bull KH Pharma Sci. 2006; 34:1. 29–33.

10. Cha BS. Step to Internal Medicine Endocrinology. 4th edition. Seoul: Jungdam publishing company;2018. p. 389

11. The Korean Academy of Clinical Geriatrics. Principles of Geriatric Medicine. Seoul: Hankookbook;2011. p. 232–46.

12. Choi HJ, Park JN. Management of Risk of Statin Therapy. J Korean Acad Fam Med. 2004; 25:713–20.

13. Park SA, Jo HK, Yoo HR, Kim YS, Seol IC, An JJ. The Effects of Gamijihwang-tang(GJT) on Hyperlipidemia in Rats. Korean J Orient Int Med. 2009; 30:2. 338–54.

14. Kim JC. SIM Integral medicine. Part III; Cardiology. Seoul: Jungdam;2013. p. 205–8.

15. Rao RM, Yang L, Garcia-Cardena G, Luscinskas FW. Endothelial-Dependent Mechanisms of Leukocyte Recruitment to the Vascular Wall. CircRes. 2007; 101:3. 234–47.

16. Ito T, Ikeda U. Infammatory cytokines and cardiovascular disease. Curr Drug Targets Inflamm Allergy. 2003; 2:257–65.

17. Habukuihakwon. Youngchu-kyungkyosuk. Beijing: Inminwishen publisher;1982. p. 161

18. Son BD. Hyperlipidemia Treatment 47 Clinical Experiences. Shanghai Journal of Traditional Chinese Medicine. 1990; 8:7–8.

19. Bang HJ, Tak ES, Hong Y, Kang YH. A Study on The Oriental-medical Understanding of Hyperlipidemia. The Journal of east-west medicines. 1995; 20:1. 25–36.

20. Herbalmedicine Compilation Committee of College of Oriental Medicine. Herbal medicine. 2nd edition. Seoul: Younglimsa;2010. p. 369p. 411–2. p. 453p. 458

21. Jang WS, Kim YS, Seol IC. Antioxidant and Lipid-lowering Effects of Artemisia capillaris on a Rat Model of Hyperlipidemia. The Journal of Korean Oriental Medicine. 2012; 33:2. 11–24.

22. Arafa HM. Curcumin attenuates diet-induced hypercholesterolemia in rats. Med Sci Monit. 2005; 11:7. 228–34.

23. Park SA, Jo HK, Yoo HR, Kim YS, Seol IC, An JJ. Lipid-lowering and Antioxidant Effects of Curcuma Radix in Poloxamer 407-induced Hyperlipidemia Model in Rat Models. Korean J Orient Int Med. 2011; 32:2. 243–58.

24. Li HB, Fang KY, Lu CT, Li XE. Study on lipid-regulating function for the extracts and their prescriptions from Semen Cassiae and fructus crataegi. Zhong yao cai. 2007; 30:5. 573–5.

25. Kim MS, Seo IB, Kim JB. Effects of Salviae Miltiorrhizae Radix on the Diet-induced Hyperlipidemia in Rats, Korean J. Oriental Physiology & Pathology. 2004; 18:2. 431–5.

26. Manconi F, Markham R, Fraser IS. Culturing endothelial cells of microvascular origin. Methods in Cell Science. 2000; 22:89–99.

27. Kwon HK, Hwang JS, So JS, Lee CG, Sahoo A, Ryu JH, et al. Cinnamon extract induces tumor cell death through inhibition of NFkappaB and AP1. BMC Cancer. 2010; 10:392

28. Tsai KL, Kao CL, Hung CH, Cheng YH, Lin HC, Chu PM. Chicoric acid is a potent anti-atherosclerotic ingredient by antioxidant action and anti-inflammation capacity. Oncotarget. 2017; 8:18. 29600–12.

29. Chung IM, Kim KH, Ahn JK. Screening of Korean medicinal and food plants with antioxidant activity. Kor J Med Sci. 1998; 6:311–22.

30. Kim MJ, Park EJ. Feature Analysis of Different In Vitro Antioxidant Capacity Assays and Their Application to Fruit and Vegetable Samples. Journal of the Korean society of food science and nutrition. 2011; 40:7. 1053–62.

31. Lee SO, Lee HJ, Yu MH, Im HG, Lee IS. Total Polyphenol Contents and Antioxidant Activities of Methanol Extracts from Vegetables produced in Ullung Island. Korean J Food Sci Technol. 2005; 37:2. 233–40.

32. Chae SW. Function and Activation of NF-κB in Immune System. Korean J Otolaryngol. 2005; 48:284–8.

33. Kim DH, Chung JH, Yoon JS, Ha YM, Bae SJ, Lee EK, et al. Ginseno-side Rd inhibits the expressions of iNOS and COX-2 by suppressing NF-κB in LPS-stimulated RAW264.7 cells and mouse liver. J Ginseng Res. 2013; 37:54–63.

34. Cobb MH, Goldsmith EJ. Dimerization in MAPkinase signaling. Trends Biochem Sci. 2000; 25:1. 7–9.

35. Orton RJ, Sturm OE, Vyshemirsky V, Calder M, Gilbert DR, Kolch W. Computational modelling of the receptor-tyrosine-kinase-activated MAPK pathway. The Biochemical Journal. 2005; 392:2. 249–61.

36. Dhanasekaran DN, Reddy EP. JNK signaling in apoptosis. Oncogene. 2008; 27:48. 6245–51.

37. Segales J, Perdiguero E, Munoz-Canoves P. Regulation of Muscle Stem Cell Functions: A Focus on the p38 MAPK Signaling Pathway. Frontiers in Cell and Developmental Biology. 2016; 4:91

38. Christopherson K, Hromas R. Chemokine Regulation of Normal and Pathologic Immune Responses. Stem Cells. 2001; 19:5. 388–96.

39. Rong Y, Geng Z, Lau BH. Ginko biloba attenuates oxidative stress in macrophages and endothelial cells. Free Radic Biol Med. 1996; 20:121–7.

40. Han KH. Dyslipidemia, Inflammation and Atherosclerosis. Cardiovascular Update. 2004; 6:3. 6–13.