Home | Register | Login | Inquiries | Alerts | Sitemap |  


Advanced Search
JKM > Volume 37(1); 2016 > Article
Um and Kim: Effect of Samhwangsasim-tang and Daehwanghwangryunsasim-tang on Palmitate-induced Lipogenesis in HepG2 cells

Abstract

Objectives:

The goal of this study was to investigate the anti-lipogenic effects of Samhwangsasim-tang(SHT), Daehwanghwangryunsasim-tang(DHT) aqueous extract on HepG2 cells with palmitate.

Materials and Methods:

HepG2 cells treated with palmitate were used in this study as hepatic steatosis model. Cells were treated with different concentrations of SHT, DHT aqueous extract for 24 hours. Cell viability and cytotoxicity were analyzed by MTT assay. Expressions of Bcl-2, Bax, Survivin, P21, TGF-β1, LXR-α, ChREBP, ACC1, SCD1 mRNA were determined by Real-time PCR. Apoptosis of cells was detected by ELISA and FACS. Expression level of caspase-3 was studied by Western blot. Lipid accumulation was indicated by Oil Red O staining.

Results:

SHT, DHT aqueous extract had no cytotoxicity, but decreased palmitate-induced lipid accumulation in HepG2 cells. SHT aqueous extract suppressed fatty acid synthesis by inhibiting LXR-α, ChREBP, SCD1 activation and increasing TGF-β1 expression level. DHT aqueous extract also suppressed fatty acid synthesis by decreasing ChREBP expression and increasing TGF-β1 expression. Apoptosis of lipid accumulated cells was increased by enhanced activities of P21, caspase-3 and inhibited expressions of Bcl-2, Survivin.

Conclusions:

These results suggest that SHT and DHT have an anti-lipogenic effects on lipid accumulation of hepatic cell. Also SHT and DHT have an efficacy to increase apoptosis of adipocyte without cytotoxicity. Therefore, SHT and DHT might have potential clinical applications for treatment of hepatic steatosis.

Fig. 1.
Cell viability assay. After treatment of Palmiticacid(PA) and SHT, DHT extract on HepG2 cells, MTT assay was performed. PA was treated as 100, 200, 300 μM for 24h. PA lowered viability of HepG2 cells. On the other hand, SHT, DHT extract(100, 200, 300 μg/ml) showed no toxicity to HepG2 cells(A). SHT, DHT extract increased viability of HepG2 cells treated with PA(B). Statistical significance was determined by one-way ANOVA test, #p<0.05, ##p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to control.
jkm-37-1-62f1.tif
Fig. 2.
Bcl-2, Bax, Survivin, P21 mRNA Expression Level. PCR was performed with 1 μl of cDNA in 20 μl reaction mixtures that comprised 10 ml of Power SYBR Green PCR Master Mix, 2 μl of primers, and 7 μl of PCR-grade water. The reactions were performed with a denaturation step at 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. The crossing point of the target genes with β-actin was calculated using the formula 2 (targetgene–ß actin), and the relative amounts were quantified. HepG2 cells were treated with 300 μM of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. Relative mRNA levels of Bcl-2(A), Bax(B), Survivin(C), P21(D) are represented on each bar graph. Statistical significance was determined by one-way ANOVA test.Also Bonferroni’s test and Student’s t-test were used to compare each set of data, #p<0.05, ##p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group.
jkm-37-1-62f2.tif
Fig. 3.
SHT, DHT Extract Induced Apoptosis in HepG2 Cells. Apoptotic cells were detected by cell death detection ELISA kit(A)(B). Bar gragh shows relative gradient of apoptosis in SHT, DHT-treated groups compared to PA-treated group. Statistical significance was determined by one-way ANOVA test, #p<0.05, ##p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group.
jkm-37-1-62f3.tif
Fig. 4.
FACS Histograms of Apoptosis Assays by Annexin V-FITC/PI Staining Method in HepG2 Cells. HepG2 cells were treated with 300 μM of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. The sums of proportion of early and late stage apoptotic cells are represented on each graph.
jkm-37-1-62f4.tif
Fig. 5.
The Cleaved Form of Caspase-3 Expression Level. SHT, DHT extract both showed concentration dependent increase of expression level of caspase-3.
jkm-37-1-62f5.tif
Fig. 6.
TGF-β1, LXR-α, ChREBP, ACC1, SCD1 mRNA Expression Level. HepG2 cells were treated with 300 μM of PA and 0, 150, 300 μg/ml of SHT, DHT extract for 24 hours. Relative mRNA levels of TGF-β1(A), LXR-α (B), ChREBP(C), ACC1(D), SCD1(E) are represented on each bar graph. Statistical significance was determined by one-way ANOVA test.Also Bonferroni’s test and Student’s t-test were used to compare each set of data, #p<0.05, ##p<0.01 PA-treated group compared to control, *p<0.05, **p<0.01 SHT, DHT-treated group compared to PA-treated group.
jkm-37-1-62f6.tif
Fig. 7.
Oil Red O staining of HepG2 Cells. PA 300 μM for 24 h induced lipid accumulation in HepG2 cells. The cells were stained with Oil Red O and observed by microscope(×200): Control group cells were treated with only 1% BSA. Lipid accumulation was decreased in PA+SHT 150 μg/ml group, and the least lipid accumulation was observed in PA+SHT 300 μg/ml group(A). Also, lipid accumulation was lowered in PA+DHT 150 μg/ml group, and the least lipid accumulation is detected in PA+DHT 300 μg/ml group(B).
jkm-37-1-62f7.tif
Table 1.
Primer Sequences for PCR.
Genes Primer sequence Size (bp)
Bcl-2 5′-GATTGATGGGATCGTTGCCTTA-3′
5′-CCTTGGCATGAGATGCAGGA-3′
200
Bax 5′-GGATGCGTCCACCAAGAAG-3′
5′-GCCTTGAGCACCAGTTTGC-3′
216
Survivin 5′-GGCCCAGTGTTTCTTCTGCTT-3′
5′-GCAACCGGACGAATGCTTT-3′
91
P21 5′-CAGACCAGCATGACAGATTTC-3′
5′-TTAGGGCTTCCTCTTGGAGA-3′
66
TGF-β1 5′-TGAACCGGCCTTTCCTGCTTCTCATG-3′
5′-GCGGAAGTCAATGTACAGCTGCCGC-3′
152
LXR-α 5′-GCCGAGTTTGCCTTGCTCA-3′
5′-TCCGGAGGCTCACCAGTTTC-3
187
ChREBP 5′- CAGCTGCGGGATGAGATTGA-3′
5′-AAACGCTGGTGTGTGATGGGTA-3′
95
ACC1 5′-AGTGAGGATGGCAGCTCTGGA-3′
5′-TGAGATGTGGGCAGCATGAAC-3′
132
SCD1 5′ CCGGGAGAATATCCTGGTTT 3′
5′ GCGGTACTCACTGGCAGAGT 3′
97
β-actin 5′-GCGAGAAGATGACCCAGATC-3′
5′-GGATAGCACAGCCTGGATAG-3′
77
Prescription of Samhwangsasimtang(SHT), Daehwanghwangryeonsasimtang(DHT)
Scientific name Volume(g)

Herbs of DHT 대황 RheiRhizoma 40
황련 CoptidisRhizoma 20
황금 Scutellariae Radix 20

total amount 80

Scientific name Volume(g)

Herbs of SHT 대황 RheiRhizoma 48
생지황 Rehmanniae Radix 32
황련 CoptidisRhizoma 16
황금 Scutellariae Radix 16

total amount 112

참고문헌

1.. Bellentani, S, Bedogni, G, Miglioli, L, & Tiribelli, C. The epidemiology of fatty liver. European journal of gastroenterology & hepatology, (2004). 16(11), 1087-1093.
crossref

2.. Marchesini, G, Brizi, M, Morselli-Labate, AM, Bianchi, G, Bugianesi, E, & McCullough, AJ, et al. Association of nonalcoholic fatty liver disease with insulin resistance. The American journal of medicine, (1999). 107(5), 450-455.
crossref

3.. Chalasani, N, Younossi, Z, Lavine, JE, Diehl, AM, Brunt, EM, & Cusi, K, et al. The diagnosis and management of non-alcoholic fatty liver disease: Practice Guideline by the American Association for the Study of Liver Diseases, American College of Gastroenterology, and the American Gastroenterological Association. Hepatology, (2012). 55(6), 2005-2023.
crossref

4.. Anstee, QM, & Day, CP. The Genetics of Nonalcoholic Fatty Liver Disease: Spotlight on PNPLA3 and TM6SF2. In Seminars in liver disease, (2015). 35(3), 270-290.
crossref

5.. Angulo, P. GI epidemiology: nonalcoholic fatty liver disease. Alimentary pharmacology & therapeutics, (2007). 25(8), 883-889.
crossref

6.. Ministry of Food and Drug Safety. Influence of dietary intake on non-alcoholic fatty liver disease in Koean. Cheongwon, Korea. Ministry of Food and Drug Safety;(2012.


7.. Jang, E, Shin, MH, Kim, KS, Kim, Y, Na, YC, & Woo, HJ. Anti-lipoapoptotic effect of Artemisia capillaris extract on free fatty acids-induced HepG2 cells. BMC complementary and alternative medicine, (2014). 14(1), 253.
crossref

8.. Browning, JD, & Horton, JD. Molecular mediators of hepatic steatosis and liver injury. Journal of Clinical Investigation, (2004). 114(2), 147.
crossref

9.. Park, SH. Nonalcoholic fatty liver disease: treatment. Korean Journal of Medicine, (2010). 79(5), 481-489.


10.. Han, CW, & Lee, JH. Effects of KHchunggan -tang on the nonalcoholic fatty liver disease in palmitate-induced cellular model. J Korean Oriental Med, (2011). 32(1), 109-110.


11.. Kim, SY, Kwon, JN, Lee, I, Hong, JW, Choi, JY, & Park, SH, et al. Research on Anti-lipogenic Effect and Underlying Mechanism of Laminaria japonica on Experimental Cellular Model of Non-alcoholic Fatty Liver Disease. The Journal of Korean Oriental Internal Medicine, (2014). 35(2), 175-183.


12.. Choi, MY, Woo, HJ, Kim, YC, & Lee, JH. Effects of Gamisaenggan-tang on High Fat Diet-induced Nonalcoholic Fatty Liver Disease. Korean J. Orient. Int. Med, (2009). 30(2), 365-374.


13.. Lee, JY, & Yoon, BK. Effects of Samhwangsasim -tang on obesity-related metabolic diseaseinmice. Dept. of Korean Medicine, (2014). 22(1), 93-104.


14.. Yoon, HJ, & Park, YS. Effects of Scutellariabaicalensis water extract on lipid metabolism and antioxidant defense system in rats fed high fat diet. Journal of The Korean Society of Food Science and Nutrition, (2010.


15.. Ro, HS, Ko, WK, Kim, OJ, Park, KK, Cho, YW, & Park, HS. Antihyperlipidemic Activity of Scutellarisbaicalensis Georg., Coptidis japonica Makino and RheikoreanumNakai on Experimental Hyperlipidemia in Rats. Journal of Pharmaceutical Investigation, (1996). 26(3), 215-219.


16.. Choi, SE, Jung, IR, Lee, YJ, Lee, SJ, Lee, JH, & Kim, Y, et al. Stimulation of lipogenesis as well as fatty acid oxidation protects against palmitate-induced INS-1 β-cell death. Endocrinology, (2011). 152(3), 816-827.
crossref

17.. Ramirez-Zacarias, JL, Castro-Munozledo, F, & Kuri-Harcuch, W. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with Oil Red O. Histochemistry, (1992). 97(6), 493-497.
crossref

18.. Samuel, VT, Liu, ZX, Qu, X, Elder, BD, Bilz, S, & Befroy, D, et al. Mechanism of hepatic insulin resistance in non-alcoholic fatty liver disease. Journal of Biological Chemistry, (2004). 279(31), 32345-32353.
crossref

19.. Park, SH, Jeon, WK, Kim, SH, Kim, HJ, Park, DI, & Cho, YK. Prevalence and risk factors of non-alcoholic fatty liver disease among Korean adults. Journal of gastroenterology and hepatology, (2006). 21(1), 138-143.
crossref

20.. Marra, F, Gastaldelli, A, Baroni, GS, Tell, G, & Tiribelli, C. Molecular basis and mechanisms of progression of non-alcoholic steatohepatitis. Trends in molecular medicine, (2008). 14(2), 72-81.
crossref

21.. Wahren, J, Sato, Y, Ostman, J, Hagenfeldt, L, & Felig, P. Turnover and splanchnic metabolism of free fatty acids and ketones in insulin-dependent diabetics at rest and in response to exercise. Journal of Clinical Investigation, (1984). 73(5), 1367.
crossref

22.. Chen, G, Liang, G, Ou, J, Goldstein, JL, & Brown, MS. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proceedings of the National Academy of Sciences of the United States of America, (2004). 101(31), 11245-11250.
crossref

23.. Chung, MH, & Han, SJ. Effect of composite preparation of crude drugs on experimentally induced hyperlipemia in rats-Sam WhangSasim Tang and Whang Ryun Haedok Tang. Korean Journal of Pharmacognosy (Korea Republic), (1996). 7(2), 46-54.


24.. Oh, MG, & Song, YS. Influence of RhizomaRhei water extract on the obese mouse model. J Oriental Rehab Med, (1997). 7(2), 46-54.


25.. Oltval, ZN, Milliman, CL, & Korsmeyer, SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programed cell death. cell, (1993). 74(4), 609-619.
crossref

26.. Tamm, I, Wang, Y, Sausville, ED, Scudiero, DA, Vigna, N, & Oltersdorf, T, et al. IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer research, (1998). 58(23), 5315-5320.


27.. Levkau, B, Koyama, H, Raines, EW, Clurman, B E, Herren, B, & Orth, K, et al. Cleavage of p21 Cip1/Waf1 and p27 Kip1 mediates apoptosis in endothelial cells through activation of Cdk2: role of a caspase cascade. Molecular cell, (1998). 1(4), 553-563.
crossref

28.. Porter, AG, & Jänicke, RU. Emerging roles of caspase-3 in apoptosis. Cell death and differentiation, (1996). 6(2), 99-104.
crossref

29.. Petruschke, TH, Röhrig, K, & Hauner, H. Transforming growth factor beta (TGF-beta) inhibits the differentiation of human adipocyte precursor cells in primary culture. International journal of obesity and related metabolic disorders: journal of the International Association for the Study of Obesity, (1994). 18(8), 532-536.


30.. Nam, IK, & Yoo, J. Downregulation of SGK1 Expression is Critical for TGF-β-induced Apoptosis in Mouse Hepatocytes Cells. Journal of life science, (2012). 22(11), 1500-1506.
crossref

31.. Cha, JY, & Repa, JJ. The liver X receptor (LXR) and hepatic lipogenesis The carbohydrate-response element-binding protein is a target gene of LXR. Journal of Biological Chemistry, (2007). 282(1), 743-751.
crossref

32.. Berlanga, A, Guiu-Jurado, E, Porras, JA, & Auguet, T. Molecular pathways in non-alcoholic fatty liver disease. Clinical and experimental gastroenterology, (2014). 7, 221.


33.. Repa, JJ, Liang, G, Ou, J, Bashmakov, Y, Lobaccaro, JMA, & Shimomura, I. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRα and LXRβ. Genes & development, (2000). 14(22), 2819-2830.
crossref

TOOLS
PDF Links  PDF Links
Full text via DOI  Full text via DOI
PubReader  PubReader
Download Citation  Download Citation
  Print
Share:      
METRICS
3
Crossref
8,547
View
209
Download
Editorial office contact information
3F, #26-27 Gayang-dong, Gangseo-gu Seoul, 157-200 Seoul, Korea
The Society of Korean Medicine
Tel : +82-2-2658-3627   Fax : +82-2-2658-3631   E-mail : skom1953@skom.or.kr
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Developed in M2PI