Effect of  Extract on Osteoclast Differentiation and Bone-pit Formation

Min-Youn Ahn; Hyung-Ho Lim; Ahn, Min-Youn; Lim, Hyung-Ho

doi:10.13048/jkm.17025

JKM > Volume 38(3); 2017 > Article

Ahn and Lim: Effect of Sochungryong-tang Extract on Osteoclast Differentiation and Bone-pit Formation

Original Article

The Journal of Korean Medicine 2017; 38(3): 59-72.

Published online: September 30, 2017

DOI: https://doi.org/10.13048/jkm.17025

Effect of Sochungryong-tang Extract on Osteoclast Differentiation and Bone-pit Formation

Min-Youn Ahn, Hyung-Ho Lim

Colledge of Korean Medicine, Gachon University

Correspondence to：임형호(Hyung-Ho Lim) 경기도 성남시 수정구 성남대로 1342 가천대학교 Tel：+8-31-750-8599, E-mail : omdlimhh@gachon.ac.kr

Received August 7, 2017 Revised September 19, 2017 Accepted September 20, 2017

Abstract

Objectives

This study was performed to evaluate effects of Sochungryong-tang Extract(SRE) on osteoclast differentiation and bone resorptionin order to find out the possibility for clinical use in preventing and treating osteoporosis.

Methods

To evaluate the effect of SRE on osteoclast differentiation, we induced RAW 264. 7 cells to be differentiated to osteoclasts by RANKL (receptor activator of nuclear factor-κB ligand). We measured effect on TRAP (Tartrate-resistant acid phosphatase), NFATc, cathepsin K, MMP-9, inflammation related factors, histogenesis factors and bone resorption.

Results

SRE decreased osteoclast differentiation, and also decreased expression of bone resorbing factors such as MMP-9, cathepsin K, TRAP, NFATc1, MITF, c-Fos, osteoclast stimulatory transmembrane protein, calcitonin receptor in RANKL-induced osteoclast. SRE also decreased Cyclooxygenase-2, indusible nitric oxide synthase, TNF-α, which are thought to be related with the inflammatory bone destruction.

Conclusion

SRE inhibits osteoclast differentiation and bone resorption. The results indicate that the BHT extract can potentially be applied for preventing and treating osteoporosis.

Keywords: Sochungryong-tang, Osteoclast, Bone resorption, osteoporosis

Fig. 1

Effect of SRE on cell viability.

A : RANKL(100 ng/mℓ) only

B : RANKL(100 ng/mℓ) + 18.7 μg/mℓ of SRE

C : RANKL(100 ng/mℓ) + 37.5 μg/mℓ of SRE

D : RANKL(100 ng/mℓ) + 75 μg/mℓ of SRE

E : RANKL(100 ng/mℓ) + 150 μg/mℓ of SRE

F : RANKL(100 ng/mℓ) + 300 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 2

Effects of SRE on the formation of TRAP(+) MNCs in RANKL stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

**: p<0.01 vs RANKL only

Fig. 3

Effects of SRE on (A)TRAP, (B) MMP-9 and (C)cathepsin K gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 4

Effects of SRE on (A)NFATc1, (B)c-Fos and (C)MITF gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 5

Effects of SRE on iNOS, COX-2, TNF-a, IL-6 gene expression in RANKL-stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 6

Effects of SRE on (A)OC-STAMP and (B)CTR gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs NC

## : p<0.01 vs RANKL only

Fig. 7

Effect of SRE on bone pit formation by RANKL-induced Osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Table 1

Composition of Sochungryong-tang

Herbal name	Pharmacognostic Name	Dose amount(g)
麻黃	Ephedrae Herba	6
桂枝	Cinnamomi Ramulus	6
白芍藥	Paeoniae Radix	6
半夏	Pinelliae Tuber	6
乾薑	Zingiberis Rhizoma	4
五味子	Schizandra Fructus	2
細辛	Asari Herba	2
甘草	Glycyrrhizae Radix et Rhizoma	2

Table 2

Primers

Target gene	Forward (5′-3′)	Reverse (5′-3′)
TRAP	ACACAGTGATGCTGTGTGGCAACTC	CCAGAGGCTTCCACATATATGATGG
Cathepsin K	AGGCGGCTATATGACCACTG	CCGAGCCAAGAGAGCATATC
MMP-9	CGTCGTGATCCCCACTTACT	AGAGTACTGCTTGCCCAGGA
NFATc1	GGGTCAGTGTGACCGAAGAT	GGAAGTCAGAAGTGGGTGGA
iNOS	CCTTGTTCAGCTACGCCTTC	AAGGCCAAACACAGCATACC
MITF	GGAACAGCAACGAGCTAAGG	TGATGATCCGATTCACCAGA
b-actin	TCACCCACACTCTGCCCAT	TCCTTAATGTCACGCACCATTT

참고문헌

1. Guideline Development Committee, Korean Society of Bone Metabolism. Osteoporosis Diagnosis and Treatment. Seoul. Mincom;(2015). p. 1-10.

2. Ministry of Health and Welfare. Health Behavior and Chronic Disease Statistics. (2012.

3. Kim, SW. Management of osteoporosis: Who to treat, what to use, and for how long? Korean J Med, (2013). 85(4), 364-73.

4. Yoon, SJ, Kim, KY, Kim, GY, Nam, KW, Sim, KC, & Kim, EJ, et al. Effects of Eucommia Ulmoides Oliver and Treadmill Exercise on the Osteoporosis of Rats Caused by Glucocorticoid Induction. Korean J Oriental Physiology & Pathology, (2008). 22(4), 884-90.

5. Jeong, YH, Kim, RY, Lee, TK, & Kim, DI. Hominis Placenta suppress Calcium release, cyclooxygenase expression and PGE2 synthesis. The Journal of Oriental Obstetrics & Gynecology, (2005). 18(1), 55-63.

6. Kim, EJ, Kim, GY, Kim, YE, Jang, MK, Kim, YI, & Kim, HW, et al. Effect of Biochemical Makers of Bone Metabolism by Administration of Achyrantes Radix Concentration in Ovariectomized Rats. Korean J Oriental Physiology & Pathology, (2007). 21(4), 967-72.

7. Hwang, JS, Seo, BI, Park, JH, Roh, SS, Kim, MR, & Kim, SM, et al. Effect of Cervi Cornu On treatment of Osteoporosis in Ovariectomized Rats. Kor J Herbology, (2010). 25(2), 1-10.

8. Koo, YM, Kim, SH, Kim, EY, Lee, HS, Choi, H, & Sohn, YJ, et al. Effects of Lycii Fructus on the Ovariectomized Osteoporosis of Rats. J Korean Oriental Med, (2008). 29(3), 144-54.

9. Seo, GT, Seo, BI, Park, JH, Lee, ES, Choi, DJ, & Choi, HS, et al. Effect of Polygoni Multiflori Radix and Polygoni Multiflori Radix Preparat On Prevention of Osteoporosis In Ovariectomized Rats. Kor J Herbology, (2005). 20(2), 137-48.

10. Kwak, HB, & Choi, MK. Inhibitory Mechanism of Curcumin in Osteoclast Differentiation. Korean J Oriental Physiology & Pathology, (2008). 22(4), 796-801.

11. Han, DH, An, JJ, Jo, HK, Yoo, HR, Kim, YS, & Seol, IC. Experimental Studys of GMJST on Bone Growth Factors;Proliferation of Osteoblast and Supression of Osteoclast. Korean J Oriental Physiology & Pathology, (2008). 22(4), 802-9.

12. Han, DH, Kang, HJ, An, JJ, Jo, HK, Yoo, HR, Seol, IC, & Kim, YS. Effect of Gucheokbogol-tang in Proliferation and Calcification of Osteoblast. Korean J Oriental Physiology & Pathology, (2008). 22(1), 142-7.

13. Shim, KS, Lee, JH, Lee, JH, & Ma, JY. Effect of Ssangwha-tang Fermented by Lactobacillus fermentum on Osteoclast Differentiation and Osteoporosis of Ovariectomized Rats. KOREAN JOURNAL OF ORIENTAL MEDICINE, (2010). 16(1), 149-55.

14. Park, SM, & Yoo, DY. Effects of Samkieumgamibang Extract on Osteoclast Differentiation and Osteoblast Function. The Journal of Oriental Obstetrics & Gynecology, (2012). 25(2), 23-42.

15. Park, CS, & Sohn, YJ. A Study on the Effects of Gamisoyosan on Ovariectomized Osteoporosis in Rats. The Journal of Oriental Obstetrics & Gynecology, (2008). 21(1), 1-15.

16. Seo, MS, Kim, HC, Choo, WJ, Jeong, SY, Kim, SJ, & Choi, JU, et al. The Review on the Study of Osteoporosis in Korean Medicine Journals. The Journal of Korea CHUNA Manual Medicine for Spine & Nerves, (2013). 8(2), 67-78.

17. Lee, SY, Seo, BI, Park, JH, Noh, SS, & Kim, DJ. Effect of Ligustri Lucidi Fructus Extract and Vici Herba Extract on Treatment of Osteoporosis in Ovariectomized Rat. KOREAN JOURNAL OF ORIENTAL MEDICINE, (2011). 17(1), 153-65.

18. Song, KC, & Hwang, GS. Effects of Houyttnia cordata on bone marrow stromal cell and osteoporetic rat. Kor JOriental Preventive Medical Society, (2009). 13(2), 103-13.

19. Ju, IH, Lee, EK, Hwang, GS, & Chong, MS. Effects of Saengmaek-san(SM) on osteoclastogenesis and gene expression. Kor J Oriental Preventive Medical Society, (2015). 19(2), 135-44.

20. Amagaya, S, Iizuka, A, Makino, B, Kubo, M, Komatsu, Y, & Cheng, FC, et al. General pharmacological properties of Sho-seiryu-to (TJ-19) extracts. Phytomedicine, (2001). 8(5), 338-47.

21. Jung, JW, Kang, HR, Kim, JY, Lee, SH, Kim, SS, & Cho, SH. Are asthmatic patients prone to bone loss? Ann Allergy Asthma Immunol, (2014). 112(5), 426-31.

22. Lee, EJ, Choi, BK, Hwang, ES, & Chang, EJ. Interleukin-32 Gamma as a new face in inflammatory bone diseases. J Rheum Dis, (2017). 24(1), 14-20.

23. Cosman, F, de Beur, SJ, & LeBoff, MS, et al. Clinician’s guide to prevention and treatment of osteoporosis. Osteoporos Int, (2014). 25, 2359-81.

24. The Korean Acamdemy of Clinical Geriatrics. Principles of Geriatric Medicine. Seoul. HanKukmb;(2011). p. 399

25. Kim, JH, & Shin, HK. Analysis of Biological Experiment on Socheongryong-tang(Xiaoqinglong-tang). J Korean Oriental Med, (2012). 33(3), 54-73.

26. Woo, YJ, Lee, MY, Lim, HS, Shin, IS, Kim, YJ, & Jin, SE, et al. Experimental Studies on the inflammation-related diseases pharmacological effect of water and 70% ethanol extracts from Socheongnyong-tang. Fomula science, (2012). 20(2), 13-28.

27. Yavropoulou, MP, & Yovos, JG. Osteoclstogenesis Current knowledge and future perspectives. J Musculoskelet Neuronal Interact, (2008). 8(3), 204-16.

28. Kim, HK, Kim, JS, Yoon, SH, & Ryu, BH. Radioprotective Effect of Saengmaek-san on Mice Jejunal Crypt Cell Survival and Apoptosis. Kor J Orient Int Med, (2006). 27(2), 316-26.

29. Kim, JY, & Hwang, GS. The effects of Cuscuta japonica Chois on gene expression in RANKL -induced RAW 264.7 cell. Kor J Oriental Preventive Medical Society, (2010). 14(2), 77-89.

30. Pang, M, Martinez, AF, Fernandez, 1, Ba1kan, W, & Troen, BR. AP-1 stimulates the cathepsin K promoter in RAW 264.7 cells. Gene, (2007). 403(1–2), 151-8.

31. Yoo, M, Youn, Y, Lee, N, & Choi, S. Cellu1ar proteins related to osteoclastogenesis in RAW 264.7 cells. Cancer Prevention Research, (2007). 12, 310-8.

32. Kim, SJ, Lee, JJ, Kim, JH, Jo, SH, Park, MC, & Jo, EH. Inhibitory Effects of Ssangbohwan on Osteoclast Differentiation and Bone Resorption. The Acupuncture, (2015). 32(3), 69-81.

33. Choi, KH, Yoo, JE, Hwang, GS, & Yoo, DY. Effects of Cordyceps militaris(CM) on osteoclastogenesis and gene expression. The journal of oriental obstetrics & gynecology, (2012). 25(3), 16-26.

34. Yim, CY. Nitric oxide and cancer. Korean journal of internal medicine, (2010). 78, 430-6.

35. Han, M, Wen, JK, Zheng, B, & Zhang, DQ. Acetylbritannilatone suppresses NO and PGE2 synthesis in RA W 264.7 macrophages through the inhibition of iNOS and COX-2 gene expression. Life Science, (2004). 75, 675-84.

36. Seo, WG, Pae, HO, Oh, GS, Kim, NY, Kwon, TO, & Shin, MK, et al. The aqueous extract of Rhodiola sachalinensis root enhances gene in RAW264.7 macrophage. J Ethnophamacol, (2001). 76, 119-23.

37. Horwood, HJ, Page, TH, McDaid, JP, Palmer, CD, Campbell, J, & Mahon, T, et al. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6 production. L Immunol, (2006). 176(6), 3635-41.

38. Turini, ME, & DuBois, RN. Cyclooxygenase-2: a therapeutic target. Annu Rev Med, (2002). 53, 35-57.

39. Yang, M, Birnbaum, MJ, MacKay, CA, Mason-Savas, A, Thompson, B, & Odgren, PR. Osteoclast stimulatory transmembrane protein (OC-STAMP), a novel protein induced by RANKL that promotes osteoclast differentiation. J Cell Physiol, (2008). 215(2), 497-505.

40. Kim, MH, Chun, YN, & Yim, MJ. Effect of pentoxifylline, a phosphodiesterase, on osteoclast formation. Yakhak Hoeji, (2004). 48(3), 197-201.