Effect of Sochungryong-tang Extract on Osteoclast Differentiation and Bone-pit Formation

Article information

J Korean Med. 2017;38(3):59-72

Publication date (electronic) : 2017 September 30

doi : https://doi.org/10.13048/jkm.17025

Min-Youn Ahn, Hyung-Ho Lim

Colledge of Korean Medicine, Gachon University

Correspondence to：임형호(Hyung-Ho Lim) 경기도 성남시 수정구 성남대로 1342 가천대학교 Tel：+8-31-750-8599, E-mail : omdlimhh@gachon.ac.kr

Received 2017 August 7; Revised 2017 September 19; Accepted 2017 September 20.

Abstract

Objectives

This study was performed to evaluate effects of Sochungryong-tang Extract(SRE) on osteoclast differentiation and bone resorptionin order to find out the possibility for clinical use in preventing and treating osteoporosis.

Methods

To evaluate the effect of SRE on osteoclast differentiation, we induced RAW 264. 7 cells to be differentiated to osteoclasts by RANKL (receptor activator of nuclear factor-κB ligand). We measured effect on TRAP (Tartrate-resistant acid phosphatase), NFATc, cathepsin K, MMP-9, inflammation related factors, histogenesis factors and bone resorption.

Results

SRE decreased osteoclast differentiation, and also decreased expression of bone resorbing factors such as MMP-9, cathepsin K, TRAP, NFATc1, MITF, c-Fos, osteoclast stimulatory transmembrane protein, calcitonin receptor in RANKL-induced osteoclast. SRE also decreased Cyclooxygenase-2, indusible nitric oxide synthase, TNF-α, which are thought to be related with the inflammatory bone destruction.

Conclusion

SRE inhibits osteoclast differentiation and bone resorption. The results indicate that the BHT extract can potentially be applied for preventing and treating osteoporosis.

Keywords: Sochungryong-tang; Osteoclast; Bone resorption; osteoporosis

Fig. 1

Effect of SRE on cell viability.

A : RANKL(100 ng/mℓ) only

B : RANKL(100 ng/mℓ) + 18.7 μg/mℓ of SRE

C : RANKL(100 ng/mℓ) + 37.5 μg/mℓ of SRE

D : RANKL(100 ng/mℓ) + 75 μg/mℓ of SRE

E : RANKL(100 ng/mℓ) + 150 μg/mℓ of SRE

F : RANKL(100 ng/mℓ) + 300 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 2

Effects of SRE on the formation of TRAP(+) MNCs in RANKL stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

**: p<0.01 vs RANKL only

Fig. 3

Effects of SRE on (A)TRAP, (B) MMP-9 and (C)cathepsin K gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 4

Effects of SRE on (A)NFATc1, (B)c-Fos and (C)MITF gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 5

Effects of SRE on iNOS, COX-2, TNF-a, IL-6 gene expression in RANKL-stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 6

Effects of SRE on (A)OC-STAMP and (B)CTR gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs NC

## : p<0.01 vs RANKL only

Fig. 7

Effect of SRE on bone pit formation by RANKL-induced Osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Table 1

Composition of Sochungryong-tang

Table 2

Primers

References

1. Guideline Development Committee, Korean Society of Bone Metabolism. Osteoporosis Diagnosis and Treatment Seoul: Mincom; 2015. p. 1–10.

2. Ministry of Health and Welfare. Health Behavior and Chronic Disease Statistics 2012.

3. Kim SW. Management of osteoporosis: Who to treat, what to use, and for how long? Korean J Med 2013;85(4):364–73.

4. Yoon SJ, Kim KY, Kim GY, Nam KW, Sim KC, Kim EJ, et al. Effects of Eucommia Ulmoides Oliver and Treadmill Exercise on the Osteoporosis of Rats Caused by Glucocorticoid Induction. Korean J Oriental Physiology & Pathology 2008;22(4):884–90.

5. Jeong YH, Kim RY, Lee TK, Kim DI. Hominis Placenta suppress Calcium release, cyclooxygenase expression and PGE2 synthesis. The Journal of Oriental Obstetrics & Gynecology 2005;18(1):55–63.

6. Kim EJ, Kim GY, Kim YE, Jang MK, Kim YI, Kim HW, et al. Effect of Biochemical Makers of Bone Metabolism by Administration of Achyrantes Radix Concentration in Ovariectomized Rats. Korean J Oriental Physiology & Pathology 2007;21(4):967–72.

7. Hwang JS, Seo BI, Park JH, Roh SS, Kim MR, Kim SM, et al. Effect of Cervi Cornu On treatment of Osteoporosis in Ovariectomized Rats. Kor J Herbology 2010;25(2):1–10.

8. Koo YM, Kim SH, Kim EY, Lee HS, Choi H, Sohn YJ, et al. Effects of Lycii Fructus on the Ovariectomized Osteoporosis of Rats. J Korean Oriental Med 2008;29(3):144–54.

9. Seo GT, Seo BI, Park JH, Lee ES, Choi DJ, Choi HS, et al. Effect of Polygoni Multiflori Radix and Polygoni Multiflori Radix Preparat On Prevention of Osteoporosis In Ovariectomized Rats. Kor J Herbology 2005;20(2):137–48.

10. Kwak HB, Choi MK. Inhibitory Mechanism of Curcumin in Osteoclast Differentiation. Korean J Oriental Physiology & Pathology 2008;22(4):796–801.

11. Han DH, An JJ, Jo HK, Yoo HR, Kim YS, Seol IC. Experimental Studys of GMJST on Bone Growth Factors;Proliferation of Osteoblast and Supression of Osteoclast. Korean J Oriental Physiology & Pathology 2008;22(4):802–9.

12. Han DH, Kang HJ, An JJ, Jo HK, Yoo HR, Seol IC, Kim YS. Effect of Gucheokbogol-tang in Proliferation and Calcification of Osteoblast. Korean J Oriental Physiology & Pathology 2008;22(1):142–7.

13. Shim KS, Lee JH, Lee JH, Ma JY. Effect of Ssangwha-tang Fermented by Lactobacillus fermentum on Osteoclast Differentiation and Osteoporosis of Ovariectomized Rats. KOREAN JOURNAL OF ORIENTAL MEDICINE 2010;16(1):149–55.

14. Park SM, Yoo DY. Effects of Samkieumgamibang Extract on Osteoclast Differentiation and Osteoblast Function. The Journal of Oriental Obstetrics & Gynecology 2012;25(2):23–42.

15. Park CS, Sohn YJ. A Study on the Effects of Gamisoyosan on Ovariectomized Osteoporosis in Rats. The Journal of Oriental Obstetrics & Gynecology 2008;21(1):1–15.

16. Seo MS, Kim HC, Choo WJ, Jeong SY, Kim SJ, Choi JU, et al. The Review on the Study of Osteoporosis in Korean Medicine Journals. The Journal of Korea CHUNA Manual Medicine for Spine & Nerves 2013;8(2):67–78.

17. Lee SY, Seo BI, Park JH, Noh SS, Kim DJ. Effect of Ligustri Lucidi Fructus Extract and Vici Herba Extract on Treatment of Osteoporosis in Ovariectomized Rat. KOREAN JOURNAL OF ORIENTAL MEDICINE 2011;17(1):153–65.

18. Song KC, Hwang GS. Effects of Houyttnia cordata on bone marrow stromal cell and osteoporetic rat. Kor JOriental Preventive Medical Society 2009;13(2):103–13.

19. Ju IH, Lee EK, Hwang GS, Chong MS. Effects of Saengmaek-san(SM) on osteoclastogenesis and gene expression. Kor J Oriental Preventive Medical Society 2015;19(2):135–44.

20. Amagaya S, Iizuka A, Makino B, Kubo M, Komatsu Y, Cheng FC, et al. General pharmacological properties of Sho-seiryu-to (TJ-19) extracts. Phytomedicine 2001;8(5):338–47.

21. Jung JW, Kang HR, Kim JY, Lee SH, Kim SS, Cho SH. Are asthmatic patients prone to bone loss? Ann Allergy Asthma Immunol 2014;112(5):426–31.

22. Lee EJ, Choi BK, Hwang ES, Chang EJ. Interleukin-32 Gamma as a new face in inflammatory bone diseases. J Rheum Dis 2017;24(1):14–20.

23. Cosman F, de Beur SJ, LeBoff MS, et al. Clinician’s guide to prevention and treatment of osteoporosis. Osteoporos Int 2014;25:2359–81.

24. The Korean Acamdemy of Clinical Geriatrics. Principles of Geriatric Medicine Seoul: HanKukmb; 2011. p. 399.

25. Kim JH, Shin HK. Analysis of Biological Experiment on Socheongryong-tang(Xiaoqinglong-tang). J Korean Oriental Med 2012;33(3):54–73.

26. Woo YJ, Lee MY, Lim HS, Shin IS, Kim YJ, Jin SE, et al. Experimental Studies on the inflammation-related diseases pharmacological effect of water and 70% ethanol extracts from Socheongnyong-tang. Fomula science 2012;20(2):13–28.

27. Yavropoulou MP, Yovos JG. Osteoclstogenesis Current knowledge and future perspectives. J Musculoskelet Neuronal Interact 2008;8(3):204–16.

28. Kim HK, Kim JS, Yoon SH, Ryu BH. Radioprotective Effect of Saengmaek-san on Mice Jejunal Crypt Cell Survival and Apoptosis. Kor J Orient Int Med 2006;27(2):316–26.

29. Kim JY, Hwang GS. The effects of Cuscuta japonica Chois on gene expression in RANKL -induced RAW 264.7 cell. Kor J Oriental Preventive Medical Society 2010;14(2):77–89.

30. Pang M, Martinez AF, Fernandez 1, Ba1kan W, Troen BR. AP-1 stimulates the cathepsin K promoter in RAW 264.7 cells. Gene 2007;403(1–2):151–8.

31. Yoo M, Youn Y, Lee N, Choi S. Cellu1ar proteins related to osteoclastogenesis in RAW 264.7 cells. Cancer Prevention Research 2007;12:310–8.

32. Kim SJ, Lee JJ, Kim JH, Jo SH, Park MC, Jo EH. Inhibitory Effects of Ssangbohwan on Osteoclast Differentiation and Bone Resorption. The Acupuncture 2015;32(3):69–81.

33. Choi KH, Yoo JE, Hwang GS, Yoo DY. Effects of Cordyceps militaris(CM) on osteoclastogenesis and gene expression. The journal of oriental obstetrics & gynecology 2012;25(3):16–26.

34. Yim CY. Nitric oxide and cancer. Korean journal of internal medicine 2010;78:430–6.

35. Han M, Wen JK, Zheng B, Zhang DQ. Acetylbritannilatone suppresses NO and PGE2 synthesis in RA W 264.7 macrophages through the inhibition of iNOS and COX-2 gene expression. Life Science 2004;75:675–84.

36. Seo WG, Pae HO, Oh GS, Kim NY, Kwon TO, Shin MK, et al. The aqueous extract of Rhodiola sachalinensis root enhances gene in RAW264.7 macrophage. J Ethnophamacol 2001;76:119–23.

37. Horwood HJ, Page TH, McDaid JP, Palmer CD, Campbell J, Mahon T, et al. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6 production. L Immunol 2006;176(6):3635–41.

38. Turini ME, DuBois RN. Cyclooxygenase-2: a therapeutic target. Annu Rev Med 2002;53:35–57.

39. Yang M, Birnbaum MJ, MacKay CA, Mason-Savas A, Thompson B, Odgren PR. Osteoclast stimulatory transmembrane protein (OC-STAMP), a novel protein induced by RANKL that promotes osteoclast differentiation. J Cell Physiol 2008;215(2):497–505.

40. Kim MH, Chun YN, Yim MJ. Effect of pentoxifylline, a phosphodiesterase, on osteoclast formation. Yakhak Hoeji 2004;48(3):197–201.

Article information Continued

Fig. 1

Effect of SRE on cell viability.

A : RANKL(100 ng/mℓ) only

B : RANKL(100 ng/mℓ) + 18.7 μg/mℓ of SRE

C : RANKL(100 ng/mℓ) + 37.5 μg/mℓ of SRE

D : RANKL(100 ng/mℓ) + 75 μg/mℓ of SRE

E : RANKL(100 ng/mℓ) + 150 μg/mℓ of SRE

F : RANKL(100 ng/mℓ) + 300 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 2

Effects of SRE on the formation of TRAP(+) MNCs in RANKL stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

**: p<0.01 vs RANKL only

Fig. 3

Effects of SRE on (A)TRAP, (B) MMP-9 and (C)cathepsin K gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 4

Effects of SRE on (A)NFATc1, (B)c-Fos and (C)MITF gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

* : p<0.05 vs NC

# : p<0.05 vs RANKL only

Fig. 5

Effects of SRE on iNOS, COX-2, TNF-a, IL-6 gene expression in RANKL-stimulated osteoclast.

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs RANKL only

Fig. 6

Effects of SRE on (A)OC-STAMP and (B)CTR gene expression in RANKL-stimulated osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

30 : RANKL(100 ng/mℓ) + 30 μg/mℓ of SRE

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Each bar represents Mean±SD of 5 tests.

** : p<0.01 vs NC

## : p<0.01 vs RANKL only

Fig. 7

Effect of SRE on bone pit formation by RANKL-induced Osteoclast.

NC : Vehicle

0 : RANKL(100 ng/mℓ) only

60 : RANKL(100 ng/mℓ) + 60 μg/mℓ of SRE

120 : RANKL(100 ng/mℓ) + 120 μg/mℓ of SRE

Table 1

Composition of Sochungryong-tang

Herbal name	Pharmacognostic Name	Dose amount(g)
麻黃	Ephedrae Herba	6
桂枝	Cinnamomi Ramulus	6
白芍藥	Paeoniae Radix	6
半夏	Pinelliae Tuber	6
乾薑	Zingiberis Rhizoma	4
五味子	Schizandra Fructus	2
細辛	Asari Herba	2
甘草	Glycyrrhizae Radix et Rhizoma	2

Table 2

Primers

Target gene	Forward (5′-3′)	Reverse (5′-3′)
TRAP	ACACAGTGATGCTGTGTGGCAACTC	CCAGAGGCTTCCACATATATGATGG
Cathepsin K	AGGCGGCTATATGACCACTG	CCGAGCCAAGAGAGCATATC
MMP-9	CGTCGTGATCCCCACTTACT	AGAGTACTGCTTGCCCAGGA
NFATc1	GGGTCAGTGTGACCGAAGAT	GGAAGTCAGAAGTGGGTGGA
iNOS	CCTTGTTCAGCTACGCCTTC	AAGGCCAAACACAGCATACC
MITF	GGAACAGCAACGAGCTAAGG	TGATGATCCGATTCACCAGA
b-actin	TCACCCACACTCTGCCCAT	TCCTTAATGTCACGCACCATTT