The Experimental Study of the Beneficial Effect of Zingiberis Rhizoma on Post-menopausal Obesity Using Ovariectomized Rats

Article information

J Korean Med. 2018;39(2):106-118

Publication date (electronic) : 2018 June 30

doi : https://doi.org/10.13048/jkm.18019

Colledge of Korean Medicine, Gachon University

Correspondence to: 임형호(Hyung-Ho Lim), 경기도 성남시 수정구 성남대로 1342 가천대학교 한의과대학, Tel: +82-31-750-8599, Fax: +82-31-750-5416, E-mail: omdlimhh@gachon.ac.kr

Received 2018 May 29; Revised 2018 June 11; Accepted 2018 June 21.

Abstract

Objectives

This study was performed to investigate anti-obesity effects of Zingiberis Rhizoma on ovariectomized rats in order to determine the possibility of the clinical use in preventing and treating post-menopausal obesity.

Methods

To investigate how menopause affects obesity in woman, rats were treated with Zingiberis Rhizoma extracts. We measured various biomarkers including GOT,GPT, leptin, ghrelin, adiponectin, PPAR-γ mRNA, total cholesterol, triglyceride, HDL-cholesterol, liver weight, estradiol, uterine weight, and calcitonin, which are linked with obesity and menopause.

Results

There was a significant decrease in group which was given Zingiberis Rhizoma extracts 100 mg/kg and lipid level found in blood(total cholesterol, triglyceride). Fat accumulation of liver cells was repressed, liver function was improved and leptin and adipomectin levels were significantly normalized. In addition, expression of PPAR-γ was significantly increased.

Conclusions

The results indicated that Zingiberis Rhizoma extracts have anti-obesity effects on ovariectomized rats through improving liver function and lipid metabolic function.

Keywords: Zingiberis rhizoma; Menopause; Obesity; Rat

Fig. 1

Weight changes of ovariectomized rats by different concentrations of Zingiberis Rhizoma extract(25, 50, 100 mg/kg)

Fig. 2

Effects of Zingiberis Rhizoma extract(100 mg/kg) to depress fat accumulation of liver tissue of ovariectomized rats (n=8). # p < 0.05, compared with the sham control. * p < 0.05, compared with the OVX control. Magnification = 40X.

Fig. 3

Effects of Zingiberis Rhizoma extract(100 mg/kg) to change PPAR-γ mRNA expression of muscle tissue of overiectomized rats. #p<0.05,compared with the sham control.*p<0.05,compared with the OVX control.

Table 2

Primers

Table 3

Effects of Zingiberis Rhizoma on Body Weight gain and Feed Efficiency Ratio of Ovariectomized Rats for 8 Weeks

Table 4

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Liver Function of Ovariectomized Rats

Table 5

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats

Table 6

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats

Table 7

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Female Hormone of Ovariectomized Rats

Table 8

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Hormone Related to Osteoporosis of Ovariectomized Rats

References

1. The society of korean medicine obstetrics and gynecology. Oreiental obstetrcis & gynecology Seoul: Euiseongdang publishing company; 2016. p. 228–9.

2. Choi YD. Clinical gynecology Seoul: Koera medical book publishing company; 2001. p. 305–26.

3. Carr MC. The emergence of the metabolic syndrome with menopause. J CLin Endocrinol Metab 2003;88:2404–11.

4. Ozebey N, Sencer E, Molvalilar S. Body fat distribution and cardiobascular disease risk factors in pre and post menopausal obese women with similar BMI. Endocr J 2002;49(4):503–9.

5. Ahn DK, Park KM, Park KW, Kang H, Kim SJ, Jang BH, et al. Effects of Herbal Mixture Extracts Containing Angelica gigas Nakai and Cuscuta chinensis Lam. on Menopausal Symptoms in Ovariectomized Rats. J Korean Soc Food Sci Nutr 2016;45(8):1083–89.

6. Winneker RC, Harris HA. Progress and prospects in treating postmenopausal vaginal atrophy. Clin Pharmacol Ter 2011;89:129–32.

7. Samat A, Rahim A, Barnett A. Pharmacotherapy for obesity in meonopausal women. Menopause Int 2008;14(2):57–62.

8. Jeonguk hanuigwadahak bonchohak gongdong gyojaepyeonchanwiwonhoe. Herbology Seoul: Younglimsa publishing company; 2016. p. 375–7.

9. Kang KH, Lee BC, Ahn SY, Doo HK, Ahn YM. The Effects of Zingiberis rhizoma on Hypothyroidism Rat induced by PTU. Korean J Orient Int Med 2006;27(3):677–87.

10. Nam SC, Kang H, Shim BS, Kim SH, Choi SH, Ahn KS. Angiogenic inhibitory effect of Zingiberis Rhizoma. J Korean Orient Oncology 2006;11(1):55–63.

11. Shin JH, Lee SJ, Sung NJ. Effects of Zingiber mioga, Zingiber mioga Root and Zingiber dfficinale on the Lipid Concentration in Hyperlipidemic Rats. J Korean Soc Food Sci Nutr 2002;31(4):679–84.

12. Mckinlay S, Jefferrys M. The menopausal syndrome. Brit J prev soc Med 1974;24:108–115.

13. Poehlman ET. Menopause, energy expenditure, and body composition. Acta Obstet Gynecol Scand 2002;81(7):603–11.

14. Meli R, Pacilio M, Raso GM, Esposito E, Coppola A, Nasti A, et al. Estrogen and raloxifene modulate leptin and its receptor in hypothalamus and adipose tissue from ovariectomized rats. Endocrinology 2004;145:3115–21.

15. Wang JF, Guo YX, Niu JZ, Liu J, Wang LQ, Li PH. Effects of Radix Puerariae flavones on liver lipid metabolism in ovariectomized rats. World J Gastroenterol 2004;10:1967–70.

16. Hong SM, Chil WH, Kim JM, Yong MJ, Lee CB, Park YS, et al. Correlation of Serum Total Testosterone with Obesity and Metabolic Syndrome in Premenopausal and Postmenopausal Women. Korean J Obes 2004;13(4):300–7.

17. You YO. Side Effects and Management of Postmenopausal Hormone Replacement Threapy. J Menopausal Med 2004;10(1):14–20.

18. Kim DI. After July 2002, What can we do for menopausal women-A review of recent research about HRT and a proposal of alternative therapies for treating climacteric or menopausal syndrome-. J Orient Obstetrics & Gynecology 2004;17(3):105–15.

19. Lee SC, Chung SI, Kang MY. Water extracts of Eucommia ulmoides improve lipid, glucose, and antioxidant metabolism in ovariectomized rats. Korean J Food Sci Technol 2016;48(6):604–9.

20. Sung HM, Shin YR, Chae HJ, Seo HY, Wee JH, Jung KO, et al. Pomegranate Extract Improves Menopausal Syndrome in Ovariectomized Rats. J Korean Soc Food Sci Nutr 2015;44(4):506–15.

21. Lee SH, Kim DC. Aqueous Extracts of Jibaekjihwang-tang Ameliorate Ovariectomy -induced Climacterium Symptoms in Mouse. J Korean Obstet Gynecol 2017;30(2):16–36.

22. Kim HC. Korea medicine pharmacology Seoul: Jipmoondang publishing company; 2001. p. 250–252.

23. Wronski TJ, Cintron M, Dann LM. Temporal relationship between bone loss and increased bone turnover in ovariectomized rats. Calcif Tissue Int 1988;43:179–83.

24. Abe T, Chow JWM, Lean JM, Chambers TJ. Estrogen does not restore bone list after ovariectomy in the rat. J Bone Miner Res 1993;8:831–8.

25. Zhang Y, Proneca R, Maffei M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425–32.

26. Yoshimatsu H, Itateyama E, Kondou S, Tajima D, Himeno K, Hidaka S, Kurokawa M, et al. Hypothalamic neuronal histamine as a target of leptin in feeding behavior. Diabetes 1999;48:2286–91.

27. Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, et al. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nature Medicine 1995;1:1155–61.

28. Perusse L, Collier G, Gagnon J, Leon AS, Rao DC, Skinner JS, et al. Acute and chronic effects of exercise on leptin levels in humans. Journal of Applied Physiology 1997;83:5–10.

29. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 1996;271:10679–703.

30. Rudman D. Effects of human growth hormone in men over 60 years old. N Engl J Med 1990;323:1–6.

31. Fatouros IG, Tournis S, Leontsini D, Jamurtas AZ, Sxina M, Thomakos P, et al. Leptin and adiponectin responses in overweight inactive elderly following resistance training and detraining are intensity related. Clin Endocrinol Metab 2005;90(11):5970–77.

32. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999;402:656–60.

33. Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, et al. Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology 2001;120:337–45.

34. Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christiansen JS, et al. Weight loss increases circulating levels of ghrelin in human obesity. Clin Endocrinol 2002;56:203–6.

35. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, et al. Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci 1994;91:7355–9.

36. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev 2000;14:1293–307.

37. Handschin C, Spiegelman BM. The role of exercise and PGC1α in inflammation and chronic disease. Nature 2008;454:463–69.

Article information Continued

Fig. 1

Weight changes of ovariectomized rats by different concentrations of Zingiberis Rhizoma extract(25, 50, 100 mg/kg)

Fig. 2

Fig. 3

Table 1

Experimental Design of Animals

Group(n)	Treatment
Sham(6)	Sham-operated rats
OVX(8)	Ovariectomized rats
OVX+Red clover(8)	Ovariectomized rats supplemented with red clover extracts 3.3 mg/kg bw/day
OVX+G-25mg/kg(8)	Ovariectomized rats supplemented with Zingiberis rhizoma extracts 25mg/kg bw/day
OVX+G-50mg/kg(8)	Ovariectomized rats supplemented with Zingiberis rhizoma extracts 50mg/kg bw/day
OVX+G-100mg/kg(8)	Ovariectomized rats supplemented with Zingiberis rhizoma extracts 100mg/kg bw/day

Table 2

Primers

Target gene	Sense (5′-3′)	Antisense (5′-3′)
PPAR-γ	TCGGAGGGCTCTGTCATC	CATCTGTACTGGTGGGGACA

Table 3

Effects of Zingiberis Rhizoma on Body Weight gain and Feed Efficiency Ratio of Ovariectomized Rats for 8 Weeks

Group1)	Initial body weight (g)	Final body weight (g)	Body weight gain (g/week)	Food intake (g/week)	Fer2)
Sham	163.2±2.98	281.5±12.3*	118.3±12.2*	8.2±0.49*	0.13±0.02*
OVX	163.0±7.18	362.3±10.33#	199.2±11.78#	9.6±0.71#	0.18±0.01#
OVX + Red Clover	163.5±5.63	362.7±23.78#	199.2±19.46#	9.2±0.60	0.19±0.02#
OVX + G-25mg/kg	163.4±6.16	367.0±18.88#	203.5±15.39#	8.9±0.55	0.20±0.01#
OVX + G-50mg/kg	163.3±6.92	360.3±20.19#	197.0±13.89#	8.9±0.54	0.20±0.02#
OVX + G-100mg/kg	164.2±5.76	339.8±18.9#,*	175.6±16.15#	9.3±0.65	0.17±0.02

¹⁾

refer to comment in table I.

Table 1

Experimental Design of Animals

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.

Table 4

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Liver Function of Ovariectomized Rats

Group1)	GOT (Karmen/mL)	GPT (Karmen/mL)
Sham	51.4±11.3*	27.5±5.8
OVX	96.7±24.1#	36.7±4.6
OVX +Red Clover	61.7±8.0	29.7±3.3
OVX + G-100 mg/kg	56.1±8.5*	29.5±4.9

¹⁾

refer to comment in table I.

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.

Table 5

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats

Group1)	Total Cholesterol(mg/dL)	Triglyceride (mg/dL)	HDL- Cholesterol (mg/dL)	Liver Weight (g)
Sham	78.8±8.7*	58.5±16.3*	39.9±5.0	9.7±0.7*
OVX	107.7±3.4#	93.7±11.2#	43.9±3.4	11.7±0.6#
OVX + Red Clover	71.6±8.3*	71.7±7.5*	42.4±5.0	11.2±1.3
OVX + G-100mg/kg	67.2±8.9*	70.7±10.8*	45.2±6.4	10.5±1.0

¹⁾

refer to comment in table I.

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.

Table 6

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats

Group1)	Leptin(pg/mL)	Ghrelin(ng/mL)	Adiponectin(ng/mL)
Sham	6.1±1.1*	57.4±0.7*	6.80±0.57
OVX	13.0±1.9#	59.2±0.3#	5.68±0.66
OVX +Red Clover	9.1±1.7	59.2±0.7	6.83±0.67
OVX + G-100 mg/kg	8.7±1.8*	58.5±0.7	7.12±0.37*

¹⁾

refer to comment in table I.

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.

Table 7

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Female Hormone of Ovariectomized Rats

Group1)	Estradiol (pg/mL)	Uterine weight (g)
Sham	52.1±9.2*	0.740±0.043*
OVX	29.7±7.5#	0.076±0.003#
OVX + Red Clover	51.9±8.9*	0.084±0.003#
OVX + G-100 mg/kg	31.5±4.2#	0.083±0.003#

¹⁾

refer to comment in table I.

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.

Table 8

Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Hormone Related to Osteoporosis of Ovariectomized Rats

Group1)	Calcitonin (pg/mL)
Sham	76.1±1.3
OVX	72.5±2.6
OVX + Red Clover	77.4±2.0
OVX + G-100 mg/kg	75.8±1.5

¹⁾

refer to comment in table I.

²⁾

Values are mean±SD.

³⁾

#p<0.05,compared with the sham control.

p<0.05,compared with the OVX control.